Skip to Content
Find More Like This
Return to Search

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

United States Patent

May 11, 2004
View the Complete Patent at the US Patent & Trademark Office
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Cruz-Perez; Patricia (Las Vegas, NV), Buttner; Mark P. (Henderson, NV)
University of Nevada (Las Vegas, NV)
10/ 080,959
February 22, 2002
GOVERNMENT CONTRACT This invention was made with Government support under DE-FG03-98ER62574 awarded by the U.S. Department of Energy. The Government has certain rights in this invention.